DNA – Untuk Tes Paternitas

Ceritanya, kemarin saya jaga stand pameran di The 4th Women’s Health Expo and Bazaar 2011. Ketika tengah memberi informasi tentang layanan Tes DNA Paternitas, ada ibu-ibu nyeletuk “Oh, iya nih lagi rame di sinetron Putri yang Ditukar, Mbak!! Itu lho, padahal si Amira sudah bisa ketahuan siapa bapak kandungnya dari awal kalo ikut tes DNA…” bla bla bla, percakapan berlanjut ke alur cerita sinetron tersebut :lol:. Tidak hanya satu ibu saja yang nyeletuk demikian, seingat saya ada 5 orang lebih yang menyinggung-nyinggung sinetron tersebut.

Langsung saya teringat kisruh-kisruh tentang sinetron ini (sumber 1, 2, 3, 4, 5 dan lain-lain) ๐Ÿ˜† . Bukan.. bukan.. bukan bermaksud ingin memperpanjang kisruh-kisruh seperti sinetron yang episodenya dipanjang-panjangkan, saya ingin berbagi informasi sedikit tentang apa itu Tes DNA Paternitas. Soalnya sekarang sudah lebih populer berkat sinetron.

Deoxyribonucleic acid

DNA (deoxyribonucleic acid) adalah molekul yang membawa informasi yang dapat diturunkan. Semacam cetak biru, kode dasar, yang menentukan protein-protein seperti apa yang akan diproduksi oleh tubuh. Simpelnya, bagaimana bentuk wajah, warna rambut, atau rambutnya keriting atau lurus, dan lain-lain.

Struktur DNA terdiri atas dua rantai polimer, yang tersusun atas unit-unit monomer disebut nukleotida. Nukleotida itu tersusun atas molekul gula pentosa, fosfat, dan basa nitrogen. Terdapat empat basa nitrogen yang menyusun DNA: adenine (A), guanine (G), cytosine (C), dan thymine (T).

Nah, yang disebut sebagai informasi genetik adalah rangkaian basa-basa nitrogen ini, AGTATATGTATCACATACAT… dan seterusnya ๐Ÿ˜› . Gabungan tiga basa nitogen disebut kodon yang akan menyandi asam amino tertentu, misal kodon GGCย  akan menyandi asam amino glisin. Dan kerennya, mulai dari bakteri sederhana sampai tubuh manusia yang sedemikian kompeks, semuanya hanya terkode atas kombinasi dari keempat basa nitrogen tersebut. Etapi nampak jauh perbedaan wujudnya :lol:.

DNA dapat ditemukan di setiap sel, misalnya antara sel rambut dengan sel darah tipe DNA-nya sama. Di dalam sel, rantai DNA yang panjangnya bisa mencapai satu meter harus digulung-gulung dengan protein histone supaya bisa muat di dalam inti sel yang diameternya hanya 10-20 mikron (0.00001 meter) (lihat Nature). DNA yang sudah menggulung dan memendek inilah yang disebut kromosom.

Setiap individu memiliki total 23 pasang kromosom, terdiri atas 22 pasang kromosom tubuh (autosom) dan sepasang kromosom kelamin kelamin (gonosom: X dan Y). Dimana separuh dari set kromosom ini diwariskan dari si bapak, dan separuh yang lain dari si ibu.

Tes DNA Paternitas

Tes paternitas adalah tes DNA untuk mencari hubungan kekerabatan antar individu. Misalnya untuk mencari bukti siapa ayah biologis dari seorang anak, atau untuk persoalan hukum antara lain warisan, adopsi, perwalian anak, tunjangan anak, imigrasi, family reunion, dan masalah forensik.

Tes paternitas dilakukan dengan membandingkan susunan informasi genetik, yang dalam bentuk AGTCACACACCAATTT.. itu :P. Karena setiap orang tua memberi kontribusi masing-masing 50% DNA-nya, maka anak biologisnya akan memiliki profil DNA yang yang sama dengan kedua orang tuanya.

Sebetulnya ada beberapa marka genetik yang dapat digunakan dalam tes paternitas. Namun, sekarang-sekarang ini yang secara luas dipergunakan oleh laboratorium forensik di seluruh dunia adalah marka STR (short tandem repeat).

Nah apakah STR itu? STR (short tandem repeat) adalah rangkaian 2-5 basa yang berulang. Misal sekuens CATG yang berulang 20 kali, jadi CATGCATGCATGCATGCATGCATG… sampai 20 kali deh *cape ngetiknya*. Biasanya STR terdapat pada bagian DNA yang tidak menyandi protein, sehingga laju mutasinya lebih tinggi. Akibatnya setiap individu punya profil STR yang khas, dan makin jauh hubungan kekerabatannya maka makin beda pula pola STR nya.

Tes DNA paternitas tidak hanya dibandingkan satu pola STR saja,ย  karena makin banyak pola yang dibandingkan maka diskriminasinya dalam membedakan masing-masing individu pun makin kuat. Saat ini umumnya laboratorium DNA forensik menggunakan sistem CODIS (Combined DNA Index System) yang kembangkan oleh FBI. Mereka membandingkan 13 marka STR yang tersebar di autosom manusia, plus AMEL untuk mengetahui jenis kelamin. Ke-13 marka STR ini umum terdapat di seluruh populasi manusia, dan variasinya pun tinggi sehingga cocok digunakan untuk proses identifikasi.

Nah sekarang bagaimana cara mengintepretasi hasil pemeriksaan STR. Berikut adalah contoh hasil tes paternitas yang saya dapatkan dari DNA-worldwide.

Tabel tersebut merupakan hasil pemeriksaan STR sampel anak dan terduga bapak. Misal kita lihat di marka STR D251338, si anak punya pola 10 dan 12 ulangan sekuens STR. Karena masing-masing kontribusi bapak dan ibu adalah 50:50. Maka kita asumsikan 10 dan 12 itu salah satunya berasal dari ibu atau si bapaknya. Sedangkan pola STR terduga bapak, terdapat pola 12 dan 13 pengulangan. Ada kecocokan antara dua orang ini, sama-sama punya pola 12.

Nah tentu bukti ini harus diperkuat oleh uji statistik, yaitu melalui perhitungan Parentage Index (PI). Setelah seluruh 13 marker ini dihitung, seluruh PI digabungkan dan dihitung nilai Combined Parentage Index (CPI). Seorang terduga bapak dipastikan merupakan bapak biologis si anak, jika memiliki nilai CPI di atas 100. Di mana CPI bernilai 100 itu sebanding dengan Probability of Paternity (POP) 99,0000%. Namun nilai POP yang dihasilkan melalui analisis STR tidak sampai mencapai 100%, paling besar 99,9999%. Mungkin saja 100% ini bisa diperoleh dengan menganalisis seluruh genome manusia, yup yang 3 juta pasang basa itu :lol:.

Tapi setidaknya dapat dipastikan. Misal, Prabu Wijaya 99,9999% adalah bapak biologis Amira.

*ditimpuk remote TV*

Advertisements

15 thoughts on “DNA – Untuk Tes Paternitas

  1. Masalahnya ini sudah menjadi ikatan batin yang tak akan bisa dipisahkan hanya karena selembar hasil tes DNA. Saya yakin, kelak Prabu, Ihsan, Rusli, Erlanda dan bahkan Wisnu seluruhnya akan melebur menjadi satu keluarga besar dan tak akan ada lagi perseteruan satu sama lain.

    *nyari ibu-ibu*

  2. Kali ini sy setuju sm Aris. Walaupun kemudian Tes DNA Paternitas membuktikan siapa orangtua kandung dari kedua putri tersebut, tapi sudah telanjur ada ikatan batin antara putri dan orangtuanya selama ini. Beruntungnya mereka karena punya dua pasang orangtua yg baik & keluarga besar yg saling menyayangi. Ihiks..
    *
    *
    *
    *
    *
    Namun tetap, sy sungguh berharap PyD ini (segera) happy ending, tidak ada sekuel/season berikutnya. Biarlah mereka hidup bahagia tanpa ada konflik/penjahat lainnya. AMIIINN.

  3. dulu pernah ada teman saya yang mendampingi korban perkosaan cerita soal tes paternitas ini. si bapak yang anggota dewan tidak mau mengakui anaknya padahal setelah dites DNA katanya 99,999% bapaknya ya si bapak itu…
    tapi katanya biayanya masih mahal ya?

  4. Pingback: Tweets that mention DNA โ€“ Untuk Tes Paternitas | Time Capsule -- Topsy.com

  5. saya pertama kali lihat contoh tes paternitas itu di novel Salem Falls-nya Jodi Picoult. Sungguh lah sangat rumit sekali.. Di novel itu diceritakan untuk mencari sperma siapa yang tertinggal di tubuh korban perkosaan, dan hasilnya diperdebatkan. Keyakinan punya siapa itu sperma disetir menurut kepentingan tertentu. Halah.

    Eniwei, OOT ya mbaknya, berati jenis kelamin seorang anak itu sebenarnya “ditentukan” oleh bapaknya kah? Pan si ibu cuma bisa menyediakan kromosom X sedang si bapak yang punya Y.

    Eniwei lagi, ahli biologi di film Splice keren beud ya mbak ๐Ÿ˜ณ *halahhalahhalahhalah*
    ๐Ÿ˜†

  6. @ dnial:
    Belum tau, kan dokumen hasil Tes DNA-nya robek gara-gara diperebutkan ๐Ÿ˜ฎ
    *padahal bisa minta salinannya ke lab yang bersangkutan, dan tamat sudah ceritanya*

    @ Aris:
    Yup, hubungan emosional lebih kuat daripada sekedar hubungan genetis. AMIINNN, saya doakan semoga happy ending :mrgreen:.

    @ nonadita:
    Begitu lah mbak. Tidak pernah ada bekas anak, walaupun ada bekas istri :lol:. IRL, tes ini ada yang dilakukan untuk mencari bukti perselingkuhan. Misalnya, suami istri dalam proses hukum cerai dan pengadilan membutuhkan bukti otentik, maka suami mengetes anak-anaknya apakah memang benar anak kandungnya atau bukan. Tapi setelah menceraikan si istri, si bapak tidak semerta-merta menelantarkan anaknya, bagaimanapun mereka tetaplah anaknya :D.

    @ itikkecil:
    Iya mbak, memang masih mahal. Satu kali tes harganya 7,5 juta, sudah termasuk anak, ibu, dan terduga ayah.

  7. @ Takodok:
    Nah kalo urusan mengambil sampel di TKP kriminal, itu bagiannya ahli Forensik dan aparat hukum. Orang lab cuma nerima doang dan tidak tahu-menahu apakah ada konflik kepentingan atau tidak ๐Ÿ˜† .

    Eniwei, OOT ya mbaknya, berati jenis kelamin seorang anak itu sebenarnya โ€œditentukanโ€ oleh bapaknya kah? Pan si ibu cuma bisa menyediakan kromosom X sedang si bapak yang punya Y.

    Yup, betul. Yang menjadi penentu jenis kelamin janin adalah adanya kromosom Y. Karena disana ada “sex determining factor” yang menyebabkan diferensiasi jaringan di gonad indiferen (yang blum berkembang jadi laki-laki maupun perempuan) kemudian berkembang membentuk testis, vas diferens, dan sebangsanya. Sedangkan kalo ga ada kromosom Y, bahkan pada kelainan genetis yang cuma punya satu kromosom sex XO, individu tersebut menjadi perempuan.

    Eniwei lagi, ahli biologi di film Splice keren beud ya mbak ๐Ÿ˜ณ

    Di sini mah jarang ada ahli biologi yang keren nan tampan ๐Ÿ˜ฆ #ough #curcol *ngelirik ke fakultas sebelah*

  8. @ sora9n:
    Nah… Apalagi penikmatnya kebanyakan ibu-ibu ๐Ÿ˜† . Info yang lumayan bermanfaat toh.. *siyul-siyul*

    @ TamaGO:
    Saat ini biayanya Rp. 7.500.000,00 sudah termasuk satu paket pemeriksaan anak, ibu, dan terduga ayah. Waktu pengerjaannya 12 hari kerja ๐Ÿ˜€

    @ jensen99:
    Iyaa, ini kan rikues Mas Jensen waktu kopdar kemarin ๐Ÿ˜€

  9. Nah, yang disebut sebagai informasi genetik adalah rangkaian basa-basa nitrogen ini, AGTATATGTATCACATACATโ€ฆ dan seterusnya

    ternyata cacat genetis dimulai dari rangkaian basa-nya ya? ๐Ÿ˜†

  10. *baru sempat blogwalking* *baru baca*

    mantap! ada juga tulisan model teknis yang tidak mengawang-awang seperti ini. kudos. anda telah memberikan sumbangsih terhadap pembelajaran bangsa. apaan sih gue (worship)

    anyway, dasar-dasar DNA yang seperti CATG (atau SATG, kalau buku bahasa Indonesianya :mrgreen: ) AFAIK ada juga di pelajaran SMA kelas 11 kalau nggak salah. tapi soal STR ini baru tau juga, sih. ternyata pada dasarnya itu pembandingan urutan CATG, juga baru tahu.

    sering-sering yang kayak begini, mbakyu. ๐Ÿ˜€

  11. @ Kurology:
    ๐Ÿ˜† *baru merhatiin*

    @ yud1:
    *baru menengok blog lagi*

    Aihh.. syukurlah kalau pada ngerti apa yang saya tulis ๐Ÿ˜ณ

    anyway, dasar-dasar DNA yang seperti CATG (atau SATG, kalau buku bahasa Indonesianya :mrgreen: )

    Hoo, saya baru tahu ๐Ÿ˜ฎ .

    Tapi, IMHO, kalau diganti begitu, malah berubah dari standar internasional dan bisa membingungkan kalo si anak mencari literatur dari bahasa Inggris ๐Ÿ˜• . Dulu saya pernah baca buku teks Biologi yang sudah diterjemahkan ke bahasa Indonesia, dan sumpah.. ga ngerti ๐Ÿ˜ˆ . Ya itu karena banyak istilah (yang sudah berlaku global) kemudian diIndonesiakan :P.

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s